If you had a struggling reader....what helped? ...ETA...Question #2

[rachelpants]

I need some ideas. Reading for my 7.5 year old is seriously painful.  Ug...lol...I was comforted by the poll on the General forum that showed that some kids didn't reach fluency until they were 9 or older.

 

If you have had a struggling reader is there something that really helped such as different curriculum, vision therapy, etc?  Or was it more just time, maturity, hard work, etc?

 

Thanks!

 

Edit to add another question:

 

If you changed something (like switching curriculum or starting vision therapy)....was your child still progressing at the time you made the change?  

 

I guess what I'm wondering is, if DS *is* slowly progressing (with LOTS of hard work on his part) should I try *something* to make it easier for him or just press on? He struggles with reversals (although he seems to be improving) and now that we are about 1/3 of the way into AAR2 the readers are so very hard for him.   He also struggles with tracking ...although the tracking is more of a problem now that the readers have actual paragraphs.  Times Roman font is harder for him as well.  Up to this point with the Level 2 readers I had been holding the book and running my finger under the words and helping him along. I wonder if I have been giving too much support so I tried to have him do the holding and tracking while reading "The Bake Sale".  I wanted to see if he could catch his mistakes and correct on his own... it was a train wreck. He does fine with the Level 1 readers, however. We spend 20 minutes working on new material and 20 minutes of review on older material and have worked almost completely through Level 1 again (minus the fluency practice sheets).  He really has come a long way...it's just really hard for him.

 

His birthday is in September so we didn't start K until he was 6 and now he is nearing the end of his 1st grade year....but it is hard not to compare him to the other kids his age. I keep reminding myself that most of them have had a year more of school than him.

 

Sigh...what to do?

[CamilleBethany]

My 8 year old son (2nd grade) was/is a struggling reader. I felt like I tried everything, then picked up the Ordinary Parents Guide to teaching Reading. We skipped the first several lessons, since they were focusing on the letter sounds, and I knew he knew those. This has helped leaps and bounds with both his reading/phonics understanding, and his own confidence. We aren't done with it yet, but we've been able to move on to him reading parts of books. 

 

We'll be done with the book in the next few months, so I'm no longer concerned about him being behind.

 

Good luck! I hope you're able to find something soon that works for you and your child. 

[Garga]

I don't know if what I did was right or wrong.  I don't know whether he would have blossomed right around the time I started working with him or not.  I don't know whether or not taking him for testing would have helped, but here's what I did.

 

I made him read everything in school out loud.  Everything.  

 

We sat side by side and struggled through every single word on every single page of school work.  Science text?  Read it out loud.  Directions on a grammar exercise?  Read it out loud.  If there was a word printed on a page, we read it out loud.

 

I say we because he would need breaks.  Oh, it was painful for the two of us.  You know what it's like listening to a child struggle over the simplest words.  So, he would read a paragraph, I would read a paragraph.  He would read, I would read.

 

After about 4 months of this, things started to pick up and he didn't struggle as much.  

 

And now he reads perfectly fine.  He is even just now, for the first time ever, starting to enjoy reading (he's 11. He was 8 when we started reading out loud together.)  He actually chose to read a bit of his book OVER playing on his ipad last week.  That's pretty amazing.

[alisoncooks]

I can't really give an answer b/c we're right in the middle of it... but I've found different programs have helped in different ways with my oldest DD's reading.  One thing that gave the most measurable improvement was Dancing Bears.  But even now, she is nowhere near as fluent as her same-aged peers (in general).  We've been through DB A and are now starting on DB B (Fast Track wasn't even an option for us -- that's how painful reading was for DD.)

 

For *us*, as long as we're making steady progress, we just keep plugging away.  We've not done any sort of therapy or testing.

[Ottakee]

For my nephew it was vision therapy.  The different was amazing.  He went from hardly able to read at a 1st grade level to reading fluently above grade level very quickly.

 

For my girls, it was using the I See Sam books www.iseesam.com or www.3rsplus.com (my girls are in the testimonial/case study section) and then adding in Dancing Bears (mentioned above) and later Apples and Pears spelling.

[blessed2fosteradopt]

My daughter will be 8 in June.  We are using Dancing Bears Fast Track and I have seen improvement.  I am having her do a few pages a day and now she is actually choosing more challenging books to read.  She is nowhere near fluent but we are getting there and like alisoncooks, we will just keep plugging away. 

[Butter]

Time and practice.  He's 12 now and reads as well as his father (which isn't as well as his 7 year old brother).

[Pen]

A right program (for us was Highnoonbooks.com) and much practice in divided sessions daily ... at 7.5 my ds was a non-reader and I was taking the wait and see approach, but by 9 when he was a non-reader I knew something was wrong and he needed special program suited for dyslexia and so on, I wish I had looked into what might be causing him to struggle sooner rather than going with wait and see.

[EmilyGF]

Do you know any teacher-friends who could listen to your kids read? They generally have a good sense of what the range of "normal" is and whether this is along the normal spectrum or needs something like vision therapy.

 

(My MIL is a reading teacher and has done this for some friends of mine.)

[Hunter]

For some boys it's just an issue of time. Their brains are not ready yet. There is some research that says brains develop faster when the child runs and moves around more. Listening to music and knitting and certain other activities have show to produce brain building/healing benefits. I don't think the AO year 0 type activities are without HUGE benefits.

 

AO year 0 "curriculum"

https://www.amblesideonline.org/00sch.shtml

and forum

https://amblesideonline.org/forum/

 

As for reading curriculum, I like the first few lessons of How to Tutor/Alpha-Phonics. With just a few letters the student writes their first sentence, and then more letters are introduced a few at a time. There is a older free version of the curriculum here.

http://www.donpotter.net/pdf/blumnfeld_home_primer.pdf

 

Also copying a syllabary

http://www.thephonicspage.org/On%20Reading/webstersyllabary.html

 

And once they are reading, I like matching books and audio.

[linguistmama]

For my oldest Apples and Pears was very helpful. She doesn't have any LDs, vision issues etc. She was just slow and fasttrack really helped her.

[stutterfish]

For eldest it was vision therapy (he could read but it was v.hard work for him with obvious tracking issues and letter reversal). We also saw considerable improvement when he spent a year learning to play piano (don't ask me how that works, but it was the same for a friend's child). Age 15 he's a fluent reader, poor speller with some dyslexic tendencies and he chooses not to read fiction, but with support he's passed exams two years early, so it certainly hadn't held him back.

 

//For my youngest it was Reading Eggs. She refused to be taught how to read , and I respected her wishes. Reading eggs tipped her over from a non-reader to reader. She didn't really read until she was 9, but a year later and she's now fluent.

 

//We used a lot of audiobooks and read alouds, and were careful to avoid relative's criticisms or open comparison with other people's kids. Maintaining self esteem, confidence, and enjoyment of books/stories was the most important thing until my late starters caught up :)

[Plink]

Admitting that she was dyslexic and investing in an OG tutor and curriculum are what made the difference here.  Barton has revolutionized not only her abilities, but also her attitude toward reading.  No more tears!

[rachelpants]

I just wanted to thank everyone for your support and replies...they are really helping me think all of this through. :grouphug:  :confused1:  :confused1: :)

 

Edit to add another question:

 

If you changed something (like switching curriculum or starting vision therapy)....was your child still progressing at the time you made the change?  

 

I guess what I'm wondering is, if DS *is* slowly progressing (with LOTS of hard work on his part) should I try *something* to make it easier for him or just press on? He struggles with reversals (although he seems to be improving) and now that we are about 1/3 of the way into AAR2 the readers are so very hard for him.   He also struggles with tracking ...although the tracking is more of a problem now that the readers have actual paragraphs.  Times Roman font is harder for him as well.  Up to this point with the Level 2 readers I had been holding the book and running my finger under the words and helping him along. I wonder if I have been giving too much support so I tried to have him do the holding and tracking while reading "The Bake Sale".  I wanted to see if he could catch his mistakes and correct on his own... it was a train wreck. He does fine with the Level 1 readers, however. We spend 20 minutes working on new material and 20 minutes of review on older material and have worked almost completely through Level 1 again (minus the fluency practice sheets).  He really has come a long way...it's just really hard for him.

 

His birthday is in September so we didn't start K until he was 6 and now he is nearing the end of his 1st grade year....but it is hard not to compare him to the other kids his age. I keep reminding myself that most of them have had a year more of school than him.

 

Sigh...what to do?

[wapiti]

My two cents:  a curriculum change wouldn't cause tracking to be improved.  My suggestion, since IMO all kids should have regular eye checkups, would be to go for a regular eye checkup to a covd optometrist.  Talk about the tracking concerns and discuss whether a full developmental vision eval would be warranted.  Only after the full developmental eval, and a diagnosis of tracking problems, would you have enough info to decide whether VT might be appropriate.

[Mrs. Y]

I have had sons who struggled mightily learning how to read.  One of them didn't take off until like 9 years old, another was closer to 13!

 

The 13 year old was scaring me.  I took him to a reading specialist when he was about 12 or so and she said there was nothing she could do about it either.  We worked and worked and worked bit by bit by bit.  FINALLY he can read fairly decently at almost 16!!!!!!!!!!!!!!!!!!!!!!!!  Oh, and I did take him to vision therapy eye doctors who found no issues there either.  It wasn't that we didn't try to figure out why he wasn't reading at that age, he just couldn't.

[FairProspects]

Honestly, what made the difference was getting a full neuropsychological evaluation so that I knew strengths and weaknesses and could target instruction. Once we used targeted resources, both boys made quite a bit of progress quickly (and both required very different resources).

[Ellie]

I need some ideas. Reading for my 7.5 year old is seriously painful.  Ug...lol...I was comforted by the poll on the General forum that showed that some kids didn't reach fluency until they were 9 or older.

 

If you have had a struggling reader is there something that really helped such as different curriculum, vision therapy, etc?  Or was it more just time, maturity, hard work, etc?

 

Thanks!

 

Edit to add another question:

 

If you changed something (like switching curriculum or starting vision therapy)....was your child still progressing at the time you made the change?  

 

I guess what I'm wondering is, if DS *is* slowly progressing (with LOTS of hard work on his part) should I try *something* to make it easier for him or just press on? He struggles with reversals (although he seems to be improving) and now that we are about 1/3 of the way into AAR2 the readers are so very hard for him.   He also struggles with tracking ...although the tracking is more of a problem now that the readers have actual paragraphs.  Times Roman font is harder for him as well.  Up to this point with the Level 2 readers I had been holding the book and running my finger under the words and helping him along. I wonder if I have been giving too much support so I tried to have him do the holding and tracking while reading "The Bake Sale".  I wanted to see if he could catch his mistakes and correct on his own... it was a train wreck. He does fine with the Level 1 readers, however. We spend 20 minutes working on new material and 20 minutes of review on older material and have worked almost completely through Level 1 again (minus the fluency practice sheets).  He really has come a long way...it's just really hard for him.

 

His birthday is in September so we didn't start K until he was 6 and now he is nearing the end of his 1st grade year....but it is hard not to compare him to the other kids his age. I keep reminding myself that most of them have had a year more of school than him.

 

Sigh...what to do?

 

Spalding.

 

His "grade level" is irrelevant, as is his date of birth. :-)

 

Spalding, because of its emphasis on writing and its explicit directions on the directionality of writing each letter, really helps children avoid reversals, in addition to addressing all modalities: kinesthetic, visual, and auditory.

[kiwik]

As a short term thing does it help if he has an index card or something under the line he is reading? It would be more I dependant than you pointing and may help with keeping in the right place.

[OneStepAtATime]

As with others, just hopping curriculum didn't help..at all.  And was incredibly costly and time wasting.   And yes, they were making progress, but really, really slowly and they were terribly discouraged.  Getting an evaluation for DD and an evaluation and an eye exam through a Developmental Optometrist for DS, gave us answers and a more effective path.  It also showed us strengths that the weaknesses had been masking.  We then were able to choose appropriate curriculum and incorporate VT to target the true areas at issue and in ways and techniques that worked MUCH better for the kids, not the ineffective way we had been moving through  It made a huge difference.  Are all days easy?  No.  Not at all.  But we went from snails pace crawling with a lot of emotional baggage to fairly rapid progression and significantly increased enthusiasm after we finally had decent answers and a more targeted, informed path.  Still making our way down this road, but we are in a much better place now.

 

You might consider reading The Mislabeled Child by Brock and Fernette Eide....

[MerryAtHope]

Yes, when my son was learning to read it was slow and painful but he did make progress--and I wish I'd had the money for vision therapy earlier! That really did make a big difference for him. It wasn't a cure-all, but if tracking or other vision-processing issues are problems, it sure does help.

 

Try this:

 

Write the sentences from the reader out on a white board, in a larger font, maybe even one at a time, and see how he does with them. Is that easier? That's one possible clue that he could have a tracking issue. You may want to look at www.covd.org and consider a consultation.

 

You might also look at this article for ideas on reversals.

 

How does he do with the word cards? Do you keep these in daily review and review a portion of them each day? (you won't get through all of them, but just keep rotating through). Some kids need to see words as many as 30 times before they can read them fluently, so lots of fluency review before he gets to the readers is important. 

 

Here's a bunch of ideas you can use for both the fluency pages and the word cards to incorporate more review and make it more fun:

 

For the word cards

 

Use games to review the word cards. Pull out favorite family board games like Sorry or Candy Land, and have each player read a word before his or her turn. You might enjoy Bake the Cookies as a way of reviewing. There's also a bunch of other free games--Over Easy, Word Flippers with F/L/S, A Flock of Ducks for L1, and Feed The Anteater, Be a Lumberjack, and Wake the Sheep for L2.

 

For compound words, there's Banana Splits.

 

If your child enjoys games, consider getting the Ziggy Supplement for some folder game options you can use for review. (These were designed to go with level 1, but can be used with cards from any level.) 

 

You may also want to check out: Rhyming with Candy Hearts, which has words you can use with levels 1-3 of AAR.

 

Use the word cards to make up phrases and sentences for your child to read. Let your child also make up funny or silly ones for you (or a reading buddy) to read as well. Some kids really like that!

 

Here’s an idea for kids who like to color: take coloring pages with big spaces and write review words or phrases in blanks. When the child reads the word, they get to color that space until the picture is complete.

 

Do the activities from the activity book more than once during the current lesson, and also bring back activities from previous lessons

 

For the fluency pages–sometimes students do get overwhelmed by the amount of words on the fluency pages. A lot of these will work for readers too:

 

Take a piece or two of blank paper and cover all of the words on the page except for one or two lines (whatever won’t overwhelm your child to see). 

 

Use the viewfinder bookmark to read them.
 

Let your child highlight each line as he reads, or use a sticker to mark his progress. Some kids like to see their progress in a concrete way.

Use Sticker Dots to mark the beginning and ending of where you want him to read. These are removable, so they could work for readers or fluency pages.

Take turns reading lines with your child (or let a puppet, stuffed animal, or favorite toy take turns). Many kids enjoy having a “reading buddy.†You can also use buddy reading with her readers: You can alternate lines or pages in a reader (and you can do a reader 3 times this way–one time your child reads even pages and you read odds, another time you switch, and a third time your child might try it all by him or herself). Reading the story extra times will help your child's familiarity with the words to increase both fluency and comprehension.

Use the page for your reference only and write the words, phrases, or sentences one at a time on a white board.  When your child can read one line well, try writing two lines at a time.

Make the words/phrases/sentences with tiles for your child to read.

Mix up the exercises a bit more–do something from the next step and then just a bit of the fluency reading from the previous step. This will stretch the next step out a bit more, and give a bit more fluency practice, without having the practice be all together in one chunk.

Use the words, phrases, and sentences to come up with a little book together that your child can read.  Put one phrase or sentence on each page, and let your child draw a picture, or cut and paste pictures from a magazine on each page.  My kids used to really enjoy making up little books like this.

 

HTH some! Merry :-)

[FO4UR]

Dancing Bears Fast Track

 

 

 

 

My personal opinion is that you cannot give a struggling reader too much support. Kids WANT to read, all of them do.  The lack is not internal motivation and so you can guess that any and all crutches are going to be shunned by the child as soon as the child is able to walk (er...read) without them.  Keep pointing, holding a card, whatever you can do to make reading easier for right now.

 

 

Get an eval.sooner rather than later.  It will help you pinpoint the exact work needed to get him reading. 

 

 

Oh, and my dyslexic knew phonics better at 7yo than most elementary school teachers.  However, he couldn't read a lick.  His reading emerged as he worked through Dancing Bears.

 

 

[Jane Elliot]

What helped:

Consistent daily practice multiple times a day, every single day

Buddy reading books that interested them (they read a page, I read a page)

Games like those that come with Phonics Pathways and OPGTR

Curricula: Reading Reflex, OPGTR, Phonics Pathways

Articles listed under reading in the article section of this site

Reading aloud to them at every opportunity from high quality literature

Audiobooks while driving or playing

 

What did not help:

Vision therapy (time consuming and didn't help at all even though we were extremely diligent)

Taking a better-late-than-early approach to reading

 

eta: On vision therapy - I am really sorry for the time we put into this because it robbed time we could have spent on actual reading instruction. I think the conclusions in this abstract are worth considering before making vision therapy the first place to turn.

 

eta again: I do agree with getting a regular eye exam (as another poster mentioned below). One of our sons has severe astigmatism for which he needs corrective lenses. He was not one of my struggling readers, but his reading did soar after he got glasses. 

[AngelaNYC]

I need some ideas. Reading for my 7.5 year old is seriously painful.  Ug...lol...I was comforted by the poll on the General forum that showed that some kids didn't reach fluency until they were 9 or older.

 

If you have had a struggling reader is there something that really helped such as different curriculum, vision therapy, etc?  Or was it more just time, maturity, hard work, etc?

 

Thanks!

 

 What worked for my ds was:  sight word flash cards, "find the mistakes" types of workbooks, short & funny poems (especially when he got to sing them), a blue or green overlay (sometimes), Sequential Spelling workbooks, and putting commonly misread words up on a wall.   

[Walking-Iris]

My ds will be 7 this summer, and he's been struggling. I'm starting to see improvement with Spalding. I'm using the WRTR book. When asked to simply read a page, he would shut down. Keeping reading within the visual and auditory realms was a bust for him. When I approach reading from a handwriting/spelling approach he started to improve. I still have him practic ereading from the OPGTR primer 

 

But I agree with others, mostly it's just constant work every day. Take lots of steps back for reviews. My ds needed to go back and just work on various phonemic awareness activities before moving on.

 

Don't worry about his grade or feel any pressure to go though those AAR levels in any time frame. Work with him where he's at. Add a writing to read type of book for a change. ETC is a good one.

 

Work on spelling as well.

 

Getting eye exams are definitely a necessity.

 

For the tracking you could just take a paint strip and cut a rectangular slit in the middle of it. This will isolate one line of print at a time. That helps my ds. 

 

Constant handwriting instruction using HWOT and gentle corrections have helped with writing reversals.

 

 

 

 

 

 

[TheAttachedMama]

I just wanted to commiserate with you! 

 

I have a 7.5 year old boy.  (His birthday is November 27th)  And teaching him to read has been a long, slow process.   I mean it is just SLOW, SLOW, HARD WORK.  We just finished AAR 1, so we are not even to AAR 2 yet.  So I really feel 'behind' when I compare him to his peers.  I WISH I was half way through AAR 2 like you.  But AAR 1 took us nearly 2 years to get through despite consistent work 5 days per week!  The thing is....I just couldn't move him ahead until he got certain concepts...you know? 

 

It just takes him a long time to catch on to things when it comes to reading and spelling.  It is especially painful for him because his little sister has zoomed past him and reads easily and naturally.  I do just about everything I can to keep them separated so they don't compare.  But that is hard to really do with siblings. 

 

We tried a couple other programs occasionally when I would get desperate and riddled with self doubt. :)    (Explode the code, OPGTR, EZ Lessons, and IEW PAL just to name a few.)  But we always came back to AAR because that seems to work the best for him.   The thing is...my son is very bright. (I know all mothers say this.  But seriously, the kid is bright!)  SO--Sometimes I suspect that he has some undiagnosed learning disability.  (Like dislexia for example.)  SO---Just a few months ago, I started researching strategies that professional reading interventionist use to help a struggling reader.  And guess what I found they did after hours of research??  A whole bunch of 'multi-sensory' and 'Orton-Gillingham' based techniques.  Pretty much exactly what we do in All About Reading and All About Spelling except they don't use that curricula....just similar approaches.  SO--I feel like we are using the right curriculum even though it is slow going.

 

We also tried vision therapy for him last year.  We went through about 8 blocks of session. (It costs $90 a pop twice a week for months.)  And honestly, I saw no real improvement.  I sort of feel like I was 'taken'.  I think vision therapy can help some kids.  But I am not sure if it was a help to my son and I can't say it was worth the cost at all.  If I could go back in time, I would NOT do vision therapy again.  My son also had problems with tracking with his eyes.  But even after all of that vision therapy, I see no improvement in his tracking abilities. 

 

We are just now starting AAR 2 with him.  And again, it is just SLOW going.  He doesn't seem to easily recognize letter groups or chunks in words.  In fact, every time he sees a word it is like he has to decode it from the beginning.  He just looks at each letter one at a time.   Even after I think he FINALLY has a word 'masatered'....it never really is mastered.  Some words he has seen like 300+ times and he still acts like they are brand new EVERYTIME he sees them.  (Like cat for example.)  Even this morning, he saw his own name in print and didn't recognize it and couldn't read it.....despite writing it several times per day his entire life and seeing it all of the time.  So I don't know what is going on there.  But that doesn't feel normal to me.

 

It is frustrating though.   I do everything I can to remain positive and be encouraging to him.  (But it sure is great to vent on this forum from time to time....so thanks to those who have 'listened.')

 

The good news?  My son LOVES reading.  He says it is his favorite subject and is always asking me if he can read to me.  Always.  Sometimes it will be 8 o'clock at night and we have to gently remind him that he can do more school in the morning.  :)   (So all of that 'remaining positive' is paying off!)  We don't do a lot of screen time, so books and toys are really his only options for entertaining himself.  And I think that helps too. 

 

This new found love for books and reading came when I slowly moved him to "real books" instead of just our AAR readers.  (Don't get me wrong, those AAR readers are great.  But these other books have really lit a fire for him.) 

 

We typically do about a 20 minute AAR lesson (that is the work!)--- and then I let him read some for-fun books to me.  (That is the fun part for him.)   These books do not always follow the AAR phonological sequence.  So there are words that he hasn't seen before.  But I just help him where needed and we continue on.  Also, some of the books that he picks to read are SUPER easy books.  But again, the point of the 'real, for fun' books is to remind him that reading is a pleasurable thing.  Because my hope is that if he has a love for books, he will continue to get better in reading even if it is hard for him.  (I don't yet have the experience to see if this will prove true.) 

 

Some of the 'for fun' books that we have read are:

1) Anything by Mo Williams

2) Bark George

3)  No David

 

Things like that.  Things typically used for guided reading. 

 

[rachelpants]

I'm on my stupid phone and putting baby down to nap....I have a few thoughts and comments, questions, etc....I'll be back! Lol. THANK YOU all again...this is all so helpful!

 

AttachedMama.....When you say your DS doesn't recognize word chunks.....is he blending or sounding out words in a segmented way?

Read this...it was super helpful to me:

http://www.righttrackreading.com/blending.html

 

P.s....my ds struggled with blending and I actually used the first few lessons of Phonics Pathways to help him get it down.

 

I'll be back! Lol ;-p

[bluedarling]

I think it was vision therapy that helped, but it also could have been age.  My firstborn was the one who struggled the most (his brother had similar eye teaming issues, but he just shut off one eye and learned to read fine!)  My oldest started reading "well" around 12yo, after completing vision therapy the 2nd time.   He also had VT when he was 7....that was worthless.  That VT was $$$$ and he did two 6 week sessions.  We moved, and the 2nd VT was so much more helpful....it was not performed by the doc himself, but an office assistant he trained to do the VT work.  The program was 1.5 years, and affordable, but covered many of the same exercises (and Interactive Metronome).    I think the 2nd VT was worth it mainly because it was a much longer program, and as the doc explained, there were good things done in his first VT, but it just wasn't long enough to make much difference.  

 

My older daugther also has had some difficulty with learning to read, but her issues seem to stem more from language processing issues than visual processing. But it was similar in that it took lots of time...no quick fixes.  We tried lots of curriculum, but what really helped was just plugging away at it bit by bit.

[TheAttachedMama]

AttachedMama.....When you say your DS doesn't recognize word chunks.....is he blending or sounding out words in a segmented way?

Read this...it was super helpful to me:

http://www.righttrackreading.com/blending.html

 

 

No, he blends just fine.  (AAR actually has great blending instructions imho.)  When I say he doesn't recognize chunks in words, I am more talking about word families or specific phonetic patterns in words.  For example, it wouldn't occur to him that cat rhymes with sat just by looking at the words despite LOTS and LOTS and LOTS of work in that direction. (Trust me---we have done word family work.  He will get it for the lesson, but never applies it to reading books.)  He doesn't just see the -at and know that sat, cat, fat, rat, mat all have that sound at the end.   Each and every time it is ccccccccaaaaaaatttttttt then mmmmmmmaaaaatttttt.  He sounds them out one at a time.  Same thing for would, could, should.  Same thing with here and there.  Or day and say.  Its like the part of his brain that sees these letter groupings within a word is not working the same way mine or my daughters does. 

[Loowit]

Both of my boys were slow at learning to read.  For my older son, I stuck with pure phonics for several years.  He knew the rules but it wasn't helping.  He had an evaluation at an autism clinic that did a lot of different testing.  He has problems with coding and executive function, along with other things.  Around this time I found Apples and Pears and started using it for his spelling.  It helped a lot.  My DH also started bringing home graphic novels from the library for DS to read.  They have less words and it really helped to keep his interest and to break things up so it wasn't walls of text.  When he was 10 he decided to take on the challenge of reading Ender's Game all on his own.  I knew it was above his reading level but he pushed through it and was so proud of himself.  It helped him gain some confidence.  He is doing much better now, but still really struggles with spelling.

 

My younger son has been struggling with reading. He turned 8 in October.  This year I added in Dancing Bears Fast Track and saw a huge improvement.  I can't say for sure it was the change in what we were using or if he would have taken off on his own, but I think it did help that I was being more consistent about making sure we did reading time.  I set a timer for 15 minutes each day and we would work through it.  Then I would let him pick a book to read.  We started out with Little Bear books and moved to A-Z mysteries.  I found having real books instead of readers kept his attention better.  I also don't let him struggle with words.  If he doesn't know it I just say it for him and that seemed to help him.  I also use my finger for him to be able to follow the words better or he seems to get lost.  I was worried it was a bad habit but I decided I would rather he learn to read.  I am pretty sure that younger son was just a bit slower than some to take off with reading.  He is doing much better now and is trying to read things on his own now, which is a big step for him.  I was so excited the day we went to the doctor's office and he went and got a book all on his own and read it to himself.  That for him was a huge step.

[TheAttachedMama]

I will also say that I talked to Merry (thanks Merry!) over on the All About Learning forum and she gave me some tips that have helped.  I will share our story in case it helps you.  (Even though we are a bit behind where you are at.)

 

One thing we did was pause and cycle through ALL of the previously mastered AAR 1 cards.   We would do 10 cards at a time, read them, reshuffle, and read them again.  And we practice, practice, practice those cards several times per day.  Once he can read them on sight and recognize them like the back of his hand, I file them behind the mastered section and move on to the next 10 words.  We took a break and went through EVERY word card again that he had previously mastered before we went on to AAR 2.  It was so hard for me to do this because it felt like we were essentially starting over....when all I wanted to do is move ahead.

 

You see, in my son's case, his problem is not understanding the concepts as I teach them.  He always understands the phontectic concept and he can always tackle and decode any of the words I put in front of him.  His problem is fluency and automaticity with the words.  At first, I thought that because he could sound out the words and understood the concept, I could just push forward and continue on with the next lesson.  I figured that there was so much review in the practice sheets and in the readers that things would be fine.  (That worked with my daughter.)   BUT I soon found myself in trouble because the readers and the fluency practice pages just became frustratingly hard for him.  The reading was just hard, arduous work.  It was not enjoyable for him at all.  And as I watched him struggle I realized that what I was asking him to do seemed the equivalent of climbing Mt. Everest!  

 

SO--we backed up and started from scratch doing the word cards.  As I said, this was really hard for me to do---but I can see it paying off now when we do the fluency pages/practice pages and the readers.  He is no longer struggling over each and every word.  If I notice he keeps tripping over a word that SHOULD have been previously mastered, I pull it back out and put it into our daily review.  For example, just recently I noticed that he kept reading the word 'had' as 'has'....so I made a word card for both of those words and we put them back into review.  (Actually, sometimes its too hard to find the card so I just make my own and review it every day.)  

 

I also started from scratch with the phonogram cards.  He was still mixing up b and d quite often.  And none of the tricks on the AAR webpage were working.  SO--I pulled out the old phonogram cards for b and d and put those into rotation.  We began to drill those daily.   Even though he had previously had those concepts and card down I brought them back out.  I also had him 'write' a "b" or a "d" with his finger on the couch while he made their sounds each time we drilled.  That way he could feel the texture of the fabric with his finger.  From what I read, if my son is dyslexic, inputting information this way into the brain can actually allow their brains to 'rewire' themselves.  So the more senses you involve in the process of learning to read the better.  SO--by having him trace the sound with his finger (tactile) while he made the sound (auditory) and looked at the card (visual) I was involving three different senses.   Now we rarely have reversals with those letters.  But anytime we do I have him trace the letter with his finger on the couch (where we read) and make the sound.  I also pulled out the ck and ch cards and put those into rotation when I noticed he was mixing those sounds up a lot while reading.  And anytime I just notice a particular letter or 'team of letters' is causing him problems I put those back into rotation. 

 

I also practice, practice, practice the reader stories.  We read each one AT LEAST three times before moving on.  Each time we read them, they get a little check next to the start of the story by their name.  When they get three checks the story has been mastered.  Repeated readings has helped with fluency too.   If there is a really tricky sentence in the reader, I pull it out and do a phased reading thing with it on a notepad. 

 

SO---I guess (long story short)---my advice is to not be afraid to slow down and just review, review, review those previously mastered word cards and phonograms.  I (personally) have found that trying to keep pushing forward and keep introducing new stuff was not helpful in the long run.  Whenever thongs started getting too frustrating for him, It was better (for us) to stop, review some easier stuff for awhile, and then try to move forward with the hard stuff again later.  For one thing, it helps keep their confidence up---which is huge!  And, more practice of the old stuff just makes the harder stuff seem easier. 

[konglish]

I appreciate a lot of the information and tips in this thread.  I had my DD6 see a covd optometrist for her regular yearly eye exam...and they recommended VT.  We haven't pursued it yet, but I keep wondering if reading would be easier if we did VT.  I was glad to hear the cautionary tales actually (it is $200/hr!).  It sounds like there are no shortcuts, and plugging away at it bit by bit is the most helpful.  Thanks to all of you who shared your experiences and tips.  I have a renewed sense of determination!

[RootAnn]

I never know if something I did differently helped or if my kids are just "late bloomers" and take awhile to get reading. 

 

But the review (reading at lower levels, seeing words over & over again) was never wasted. I tried just about everything with my older two (and probably will with my youngest two). They are now enthusiastic readers. Heck if I know what worked. 

[Susan in TX]

Playing Pokemon on his Nintendo is what really helped my son to read. He wanted to play the game and in order to play it, he had to read. I didn't have time to read it for him. When he came to a word he couldn't read, he would spell it out loud to me and I would tell him what it was. I honestly think that this helped more than anything else I did.

 

I also dropped phonics. He could sound out words but he couldn't remember them. He could encounter the same word in the same sentence but would have to sound it out every single time. He was terribly frustrated with Explode the Code. I switched to using Basal Readers, the Ginn series from the 60s. I stopped making him sound out words and just told him what the word he didn't know was...and then he remembered them. We also used clicknkids.com. This gave him phonics instruction without the frustration. And we used the 100 Words Kids Need to Read by... workbook series by Scholastic.

 

Susan in TX

[FairProspects]

For those using Dancing Bears, none of you had problems with those check marks at the end of each line? Ds will not even try to read the word if he thinks he will get it wrong and that ever present box is a reminder that someone is keeping track. Did anyone else have delayed reading perfectionists?

[blessed2fosteradopt]

I pretty much ignore the check marks. If my daughter sounds out a letter or blend incorrectly, I back up until she gets it right and then proceed. It has worked fine for us and she is progressing.

[alisoncooks]

I'm not so strict about the "don't give ticks and don't move on" if the student doesn't read it all right.

 

We usually go back and re-read any errors.  Sometimes I make her read that particular line again the next day.  

But most of the time I go ahead and check it to show we finished the line.

[linguistmama]

We also skipped checking the marks. I just kept track in my head and we either moved ahead or went back accordingly.

[FO4UR]

For those using Dancing Bears, none of you had problems with those check marks at the end of each line? Ds will not even try to read the word if he thinks he will get it wrong and that ever present box is a reminder that someone is keeping track. Did anyone else have delayed reading perfectionists?

 

When we started DB, I had a *very* reluctant kid.  I bribed him with candy.  For every line attempted he earned a small candy.  (smarties or skittles or M&M)  I marked lines attempted, but not mastered, with a 1/2 check.

 

At the end, we review all half-checked lines before putting the book away.  The next day, we start with all half-checked lines....and he got candy for attempting the same line whether he mastered it or not.

 

I used my judgment as to how many lines to attempt, keeping lessons to 5min tops of flashcards and 10min tops for DB book. He was motivated to attempt, and it didn't take too long before he started mastering lines.  By the end of Fast Track, half-checking had become part of the process for us.

 

Occasionally, there is a word that is British and not common in American usage and we will skip it.  Very Occasionally, he will have problems with just one word of a line and instead of doing the entire line 1000000x, we just go back to that word 1000000000x.

 

 

Otherwise, I am strict about not checking a line until it's mastered b/c that is part of what makes the DB wheel turn.  That's what keeps the child from feeling like they are drowning.  Even if you only attempt 3 lines today, it's a day well spent b/c you hit upon a tough spot and worked it.

[Loowit]

For those using Dancing Bears, none of you had problems with those check marks at the end of each line? Ds will not even try to read the word if he thinks he will get it wrong and that ever present box is a reminder that someone is keeping track. Did anyone else have delayed reading perfectionists?

 

My DS is a huge perfectionist and yes it was hard for him.  I set the timer for the time we were going to spend on it and we would get through as much as he was willing to do that day. There were days, especially in the beginning, when we barely got anything done.  He gave up at the first missed word and refused to do any more.  I stayed consistent about it and just continuing to go back to it every day, he got used to it.  It would have been easier to just give in, but due to other issue he was having I knew it was not what he needed.  I didn't make it a struggle.  I didn't try to force him to do it, I just sat and waited.  It took a lot more patience than I thought I had.  I am sure that others don't worry about the check marks and that works fine for them and their children, but I knew for my situation it would have been a mistake.

[FairProspects]

Yes, I'm actually kind of annoyed at how Dancing Bears is set up. Because there is no way I can just ignore the boxes with ds; he is desperate to get it right and really wants that check mark. He also refuses to go on when he gets one wrong or tears ensue because he already knows he is behind and he knows he should be able to read the words correctly. *Sigh* I just don't think this is the resource for us. I like the actual words and Power Pages but it is way too much pressure (put on himself) for my perfectionistic dyslexic because of those darn boxes and checks!

[Jeeves]

My 12 yo, was a struggling reader and didn't really read until he was 9.  We just kept working at it until he found a book he liked (TinTin!) and then he wanted to read it badly enough that he worked at and figured it out.  He is now a voracious reader.  However (and this is a big however!), it has come to my attention this year in school that he is struggling with non-fiction comprehension.  AND my 8 year old is in the same spot that my 12 yo was in at the same age.  So I have had them both tested--I can't tell you what we've found out because I go for the results tomorrow.  But I do know that, in hindsight, I wish I had had my 12 yo tested earlier because now, no matter what I find out with the tests, we're going to be playing catch up for awhile.   All that to say, keep working with him, but if you can afford it or if your insurance pays for it, I would check into neuropsych tests or vision tests.  Do this, if for nothing else, to check those possible causes off the list.

 

Good luck!  It's tough to watch them struggle, but keep working and start exploring other options, if you can!

Jacey

[rachelpants]

LOL....I'm finally back (and forgot everything I was going to say yesterday)....and consequently have changed my "action plan" 3x since then. I'm so tempted to try DB!

[kolamum]

Here's our story:

 

Our eldest was an eager learner & at four we progressed from learning letters to trying to sound out simple words. He could tell you the sound of any letter in the alphabet, but blending.. no. It frustrated both of us. Maturity I figured, but when I was still saying the same thing at 7 I began to believe other issues were at the heart of our problem. He KNEW every phonetic rule he'd been taught but blending was just HARD for him. Even when he did read it was slow & painful. He could not progress outside of the number {level wise} readers without falling backwards instead of forwards.

 

We scheduled an eye appointment for him, which resulted in nothing faulty but nothing quite right & we were deemed to come back in six months. By the 3rd appointment I was becoming as anxious as my child. The man KNEW something was wrong, but couldn't figure it out because everything was coming back fine. Perhaps Mum was pushing too hard & the book selections were too much. Ho-hum. It was actually here on this forum where someone mentioned their 7 year old struggling with reading & another person posted a link to vision therapy. I followed the link which had an animated graphic of words leaping across the page. My son walked by as I was looking at the website, he paused kept going & then came back. "Mum, is it just my eyes again or are the words jumping around? Cause words jump around all the time for me. Sometimes they just make a big blob on the paper & I have no idea what any of it says." 

 

I took that information & started chasing people down. We were looking at a trip to the US to say our final good-byes to a family member & we thought that since we couldn't get vision therapy where we were perhaps, just perhaps, we could pick something up in the US to use at a home. We'd contacted someone on the mainland here who was willing, after an initial visit to continue helping us via skype. So we debated pausing there on our way to or fro in order to get help. But upon lamenting to some fellow Aussie Mum's one of them mentioned Irlens, something I'd never heard of before. I googled it. She sent me the book. There was actually someone on our little island who could test & prescribe. I was beyond excited because while I knew it might not be THE answer for us it was someone we could actually get to without boarding a plane. Only thing was, she was in the US & by the time she was back we'd be in the US so we had to put off our appointment for a few months. Which seems absurd, but after trying to help our boy for that many 6 years I figured another two months wasn't going to undo us.

 

I gave the Dr a full rundown via email of our situation & the response was immediate that while she might not have ALL the answers or ALL the help she was fairly certain she could help. Now that might sound money making to you, but due to the government scheme here I wasn't going to be paying her anything. Yes, someone somewhere was, but not as much as she could have gotten if she was a private Dr for the cause. Anyway, the long awaited day arrived & she talked away with our boy who answered her with surprising answers. The one that finally caused me to bawl like a baby was when she handed him a sheet of paper that had a story on it. Told him to read. He did his best. She then told him to look at the word aeroplane, he did. Then she said to tell her what words were on each side of it. No answer. She asked again. No answer. She asked if he was okay, he looks up & says, "Look, I KNOW there are more words on this paper because you said there are & when I look at the paper I see lots of stuff on it, but when I look at aeroplane that's all I can see, everything else is blurry." 

 

It was a long appointment that had to be followed up in order for him to be given green tinted lenses. It sounds absurd, I admit it, but the proof was in the pudding for us. She gave him loner glasses after the first appointment, & this kid spent a 3 hour car trip reading. Each time we stopped to look at something or pop into a shop or use toilets we had to demand he put the book down so we could get out of the car. He went form only reading picture books, with great difficulty, to falling in love with simple chapter books like Geronimo Stilton. 4 months of wearing the glasses & he'd moved up a level & a half in reading. Was now confident enough to read chapter books, & no longer freaked out about reading in front of friends.

 

He's on his second pair now, a different tint which is common, all though they now believe his problem is a bit deeper then first expected because he hasn't lightened up his lenses yet which should happen. Having said that, I've noticed that if he wears the classes words are spelled correctly, letters are formed the correct way, numbers are turned correctly.. He commented one day that when he looked at the crazy white walls of our former home he no longer saw funky lines on them. What?! Our walls had no lines, They were smooth blah plain boring white walls. 

 

It takes a lot of patience though. Our Dr was amazing {she's now retired which made both my boy & i cry because of the new lease on life she gave him & the fear of breaking in a new Dr} & told our boy upfront that his glasses were not magical & were not going to FIX anything for him in the sense that HE still had to do the work. She has us bring in school work so she can peep at his progress & was utterly blown away with the improvement in his handwriting. Which, while always neat was also scattered, big letters-little letters. Not always in a straight line. Just beautifully formed letters, all though sometimes backwards. 

 

Once I had a baseline for his reading level it made it easier to work up. We were able to pick books that were at his reading level & progressing upwards which allows us to see his progress. For us purchasing something pre-scheduled for now is working, but once he finishes this level it'll be a different story because he'll either be ready to set himself free OR I'll have to come up with things myself. ;)

[Michelle My Bell]

I like to think of teaching reading as ocean tides. Sometimes the tide is coming in (and the child is progressing steadily) and sometimes it is going out (with the child seeming to hit a standstill.) What has worked for me is to have multiple resources I can switch between depending on where they are at. So while they are steadily working a program, (I like Dancing Bears) I continue along adding in Explode the Code. When we seem to hit a snag, we set Dancing Bears aside for a bit and use something else, even back stepping a bit if necessary. (Reading Pathways is my choice). This way the child doesn't get discouraged with their struggling. With this method, they can review material and gently begin to move forward again. Adding in computer games is always a gentle practice as well. When it seems like the right time, jump back into Dancing Bears and just keep making adjustments as you go. 

[FO4UR]

Yes, I'm actually kind of annoyed at how Dancing Bears is set up. Because there is no way I can just ignore the boxes with ds; he is desperate to get it right and really wants that check mark. He also refuses to go on when he gets one wrong or tears ensue because he already knows he is behind and he knows he should be able to read the words correctly. *Sigh* I just don't think this is the resource for us. I like the actual words and Power Pages but it is way too much pressure (put on himself) for my perfectionistic dyslexic because of those darn boxes and checks!

 

 

I wonder if you could use the words on the Power Pages on a white board?  Write one phonogram at a time, with him saying the sounds as he sees them.  Fill the board with words words words as you go, review the words already on the board - build another - review - build another - review build another.  Keep this going FAST.  If he forgets a word, erase it, build it again, review, build another, lather rinse repeat.  Make this a 5-8min warm-up.  Fast and short!

 

 

 

I've never done that, but I think it might work.  You would have to write down a list of words on a piece of paper to keep the board work flowing smoothly.  Mark the words somehow so that any word that wasn't easily known at the first gets put back on the board tomorrow.  Don't let your ds know your system....AT ALL!  

 

 

 

You could do the words on flashcards, but I think he'd be counting the cards in the stack.

 

 

 

Another grand idea...take words from the book he's going to be reading for board work.  I have isolated words from our reading before, and that is a great technique for struggling readers.  (McGuffey Readers are built on that concept.)

[RootAnn]

 So I have had them both tested--I can't tell you what we've found out because I go for the results tomorrow.  

 

Keep us updated!  :grouphug:

[MerryAtHope]

No, he blends just fine.  (AAR actually has great blending instructions imho.)  When I say he doesn't recognize chunks in words, I am more talking about word families or specific phonetic patterns in words.  For example, it wouldn't occur to him that cat rhymes with sat just by looking at the words despite LOTS and LOTS and LOTS of work in that direction. (Trust me---we have done word family work.  He will get it for the lesson, but never applies it to reading books.)  He doesn't just see the -at and know that sat, cat, fat, rat, mat all have that sound at the end.   Each and every time it is ccccccccaaaaaaatttttttt then mmmmmmmaaaaatttttt.  He sounds them out one at a time.  Same thing for would, could, should.  Same thing with here and there.  Or day and say.  Its like the part of his brain that sees these letter groupings within a word is not working the same way mine or my daughters does. 

 

This was my son--sounded out every.single.word--even the same word twice in one sentence! So laborious (for both of us!). Bless you, you're doing a great job with your son!!

[Jeeves]

Well, got the tests back and they were better than expected.  I am posting this not to take over the thread, but to encourage the OP to look into testing--either neuropsych or vision therapy.  With his tracking issues maybe vision tests first since, according to some very knowledgeable people over on the Learning Challenges Board, they tend to be the cheapest testing option, and then you can either check that off the list as not a problem, or if there is a problem, then you can pursue that track. 

 

The reason I'm encouraging testing is because I put it off for so long because I thought the issue would resolve itself, which, technically it did with the 12 yo (he learned to read and now loves to read), but the issue that probably made it difficult in the first place was still there (turns out it's ADHD with a Written Expression Disorder) and has created other problems for his schooling.  It would have been good to know this early on. But now we know and can move on using that information.

 

My 8 yo, however, was diagnosed with a "Reading Disorder," which, basically, means that we have to just keep working at it and trying different things.  Again, I'm telling you this because it's so helpful to know what's going on with him!  I was sure he was going to have dyslexia and dysgraphia and everything other learning issue and it turns out I can just call the school, see if they have any resources we can take advantage of and just keep working at it.  I think you'll feel better and have a better grasp of what to do, if you get him tested.

 

As many other posters over on the Learning Challenges Board reminded me more than once, it's always helpful to have more information! (I just didn't want to believe them! :) )

[Pen]

Dancing Bears Fast Track

 

 

 

 

My personal opinion is that you cannot give a struggling reader too much support. Kids WANT to read, all of them do.  The lack is not internal motivation and so you can guess that any and all crutches are going to be shunned by the child as soon as the child is able to walk (er...read) without them.  Keep pointing, holding a card, whatever you can do to make reading easier for right now.

 

 

Get an eval.sooner rather than later.  It will help you pinpoint the exact work needed to get him reading. 

 

 

Oh, and my dyslexic knew phonics better at 7yo than most elementary school teachers.  However, he couldn't read a lick.  His reading emerged as he worked through Dancing Bears.

 

I did not use Dancing Bears, and so cannot comment on that specifically, but I otherwise agree with this, esp bolded parts. Because you note a tracking issue, he probably both needs a COVD type eye exam, and also the type of evaluation that can show if he has dyslexia type issues.

 

However, my son had amblyopia and eye issues, but it was the work with dylexia friendly materials that made more of a difference to him.

 

Also, several short sessions may be better than single longer sessions.

 

www.talkingfingers.com which combines reading and typing might also be helpful.

 

Sometimes a pointer above the word being read is more helpful than one below--though it is easier to transition to self pointing if the finger is below.