Ausmumof3 Posted June 29, 2020 Share Posted June 29, 2020 BNO: Arizona Governor Ducey issues executive order to close bars, gyms, movie theaters, and water parks due to COVID-19 4 Quote Link to comment Share on other sites More sharing options...
TCB Posted June 29, 2020 Share Posted June 29, 2020 6 minutes ago, square_25 said: As I've been saying, hospitalizations are more evenly distributed than deaths. On the other hands, this is CFRs and not IFRs. And that is the real danger of this virus, more so than death, hospital overwhelm. 2 Quote Link to comment Share on other sites More sharing options...
brehon Posted June 29, 2020 Share Posted June 29, 2020 27 minutes ago, TCB said: And that is the real danger of this virus, more so than death, hospital overwhelm. My area is almost there (hospital, including ICU, overwhelm). 6 Quote Link to comment Share on other sites More sharing options...
TCB Posted June 29, 2020 Share Posted June 29, 2020 5 minutes ago, brehon said: My area is almost there (hospital, including ICU, overwhelm). Sorry! That’s my biggest fear, having to work in those conditions! I’ll be thinking of you! Quote Link to comment Share on other sites More sharing options...
Pen Posted June 29, 2020 Share Posted June 29, 2020 (edited) Study re Barcelona sewage that had detected some SARS2 sequence fragments (ones used for testing in France PCR tests, I think) in a March 2019 sample. Apparently Barcelona has a lot of workers from the Wuhan area, a lot of travel back and forth. this is looking more persuasive now https://www.medrxiv.org/content/10.1101/2020.06.13.20129627v1 Edited June 30, 2020 by Pen 1 1 Quote Link to comment Share on other sites More sharing options...
Ausmumof3 Posted June 29, 2020 Share Posted June 29, 2020 8 minutes ago, Pen said: Study re Barcelona sewage that had detected SARS2 in a March 2019 sample. Apparently Barcelona has a lot of workers from the Wuhan area, a lot of travel back and forth. this is looking more persuasive now https://www.medrxiv.org/content/10.1101/2020.06.13.20129627v1 I’m wondering if the virus has mutated since then to become more infectious 1 Quote Link to comment Share on other sites More sharing options...
kbutton Posted June 30, 2020 Share Posted June 30, 2020 https://www.statnews.com/2020/06/29/nejm-inflammation-children-covid19-misc/?fbclid=IwAR0stUS4PzusIK-whSbhuHYPQhrRcvC8En0lzENEBYXt4Ysn_F0YMqZPTfE 1 Quote Link to comment Share on other sites More sharing options...
Arcadia Posted June 30, 2020 Share Posted June 30, 2020 27 minutes ago, kdsuomi said: We all knew that sending inmates out of the prison in Chino because it had an outbreak to other prisons without outbreaks was stupid. Guess what set off the San Quentin outbreak? They were going to transfer inmates from San Quentin too 🤦♀️ https://www.sfchronicle.com/crime/article/Prison-officials-plan-to-transfer-150-inmates-out-15370266.php “Updated: June 26, 2020 9:55 p.m. Prison officials are planning to bus as many as 150 incarcerated people out of coronavirus-ridden San Quentin State Prison to a Bakersfield-area institution as early as Monday, sources said, in a move critics and a lawmaker said is reminiscent of the botched transfer that triggered San Quentin’s outbreak in the first place. A spokesperson for the California Department of Corrections and Rehabilitation confirmed the planned transfer, but did not specify how many people would be included. “The department is very concerned with the increase in positive COVID-19 cases in San Quentin, and in order to create more space to facilitate physical distancing, quarantine, and health care treatment efforts, CDCR will be transferring some inmates next week to North Kern State Prison,” spokesperson Dana Simas said in an email. “Every precaution is being taken before and after the transfer.” But family members of incarcerated men said they fear the move by prison officials will increase the spread of the virus, and possibly introduce the virus into yet another vulnerable community.” 1 Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 26 minutes ago, Ausmumof3 said: I’m wondering if the virus has mutated since then to become more infectious It was not actually the virus itself found. It was detection fragments , IP2 and IP4. I wonder if these were from the SARS2 virus or a something else that layer got joined with somethings else to later become the SARS2 virus 1 Quote Link to comment Share on other sites More sharing options...
kbutton Posted June 30, 2020 Share Posted June 30, 2020 More Ohio fun--a community prom. They'll have "only" 250 kids attending. In the comments, people who express concerns are being called Karen. I wish I could relocate for a while. 2 6 Quote Link to comment Share on other sites More sharing options...
Ausmumof3 Posted June 30, 2020 Share Posted June 30, 2020 26 minutes ago, CuriousMomof3 said: To me that sounds like the virus came, but for whatever reason didn't spread. Maybe there were visitors from Wuhan who had already passed the point when they were contagious, or who were asymptomatic and unlikely to spread, or only passed through the airport and pooped there. We had cases here early on, where people had the virus and it doesn't seem to have spread to any of their contacts. I think it's like embers. Sometimes they light a fire and sometimes they die out. Yes I agree particularly with how uneven the spread is 1 Quote Link to comment Share on other sites More sharing options...
EmseB Posted June 30, 2020 Share Posted June 30, 2020 24 minutes ago, kbutton said: More Ohio fun--a community prom. They'll have "only" 250 kids attending. In the comments, people who express concerns are being called Karen. I wish I could relocate for a while. It's an open air pavillion? Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 (edited) March 2019 detection in sewage? These are the IP2 and IP4 sequences from a WHO document: (I am not clear on why it is indicating Thymines for RNA sequences ? @maize, or anyone? Or is this s DNA match up probe being used to detect the RNA sequence?) “ Length (bases) PCR product size Ref. RdRp gene / nCoV_IP2 nCoV_IP2-12669Fw ATGAGCTTAGTCCTGTTG 17 108 bp 1 nCoV_IP2-12759Rv CTCCCTTTGTTGTGTTGT 18 nCoV_IP2-12696bProbe(+) AGATGTCTTGTGCTGCCGGTA [5']Hex [3']BHQ-1 21 RdRp gene / nCoV_IP4 nCoV_IP4-14059Fw GGTAACTGGTATGATTTCG 19 107 bp 1 nCoV_IP4-14146Rv CTGGTCAAGGTTAATATAGG 20 nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5']Fam [3']BHQ-1 19 “ But in the absence of other detection sequences positive, I don’t know what to think. on the one hand, sort of like finding a Hamlet soliloquy in the midst of a Old English manuscript, I don’t think it would be random chance to get both IP2 and IP4 RNA sequences for SARS2. OTOH, I don’t know what to make of it. I don’t know that it can be taken to mean that SARS2 made an early appearance in Spring 2019–but maybe it did. Curiouser and curiouser. Edited June 30, 2020 by Pen Quote Link to comment Share on other sites More sharing options...
kbutton Posted June 30, 2020 Share Posted June 30, 2020 5 minutes ago, EmseB said: It's an open air pavillion? Apparently so, but I have yet to see kids mask or social distance for any event around here yet no matter how often the organizers say they suggest masks and enforce distancing. Quote Link to comment Share on other sites More sharing options...
Tenaj Posted June 30, 2020 Share Posted June 30, 2020 6 minutes ago, EmseB said: It's an open air pavillion? It is open air. I've been there. I don't see how they can do anykind of social distancing with 25O in the pavilion but they do have grounds, so maybe they are planning to spread things out a bit. Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 https://youtu.be/qx570o5o3co Discusses a fatal case in a previously healthy young adult. DrBeen refers to him as “child” but I think he was young adult. Quote Link to comment Share on other sites More sharing options...
ktgrok Posted June 30, 2020 Share Posted June 30, 2020 1 hour ago, EmseB said: It's an open air pavillion? Well, that Oregon church that had it spread met outdoors too..but not distancing or masking and I'm sure these teens won't either. 3 Quote Link to comment Share on other sites More sharing options...
vonfirmath Posted June 30, 2020 Share Posted June 30, 2020 1 hour ago, JanOH said: It is open air. I've been there. I don't see how they can do anykind of social distancing with 25O in the pavilion but they do have grounds, so maybe they are planning to spread things out a bit. Our church youth has started out meeting (outside, in the parking lot) From what I can see, they don't all social distance. But the "groups" distanced from each other. There is enough space they could have stood around and talked and not even been as close as they did -- but it needed more encouragement, I think. Hopefully there will be more masks now. 1 Quote Link to comment Share on other sites More sharing options...
ktgrok Posted June 30, 2020 Share Posted June 30, 2020 https://www.msn.com/en-us/Health/medical/world-s-dominant-strain-of-coronavirus-is-10-times-more-infectious-than-the-one-that-jumped-to-humans-in-china-because-it-mutated-so-its-vital-spike-protein-doesn-t-snap-as-often-in-the-body-scientists-say/ar-BB167e7l?ocid=ob-fb-enus-280&fbclid=IwAR1iy_3krSHwjGW2-VidI6S7JCInNGWvzsaGpV61jlJGyt8wPLaj9KdQduo 4 1 1 Quote Link to comment Share on other sites More sharing options...
ElizabethB Posted June 30, 2020 Share Posted June 30, 2020 4 hours ago, square_25 said: I was thinking that, actually... how much preschool would DD4 attend, anyway, if I didn't send her whenever she had symptoms? In a normal year, not much! If everyone keeps their kids home when they have symptoms, everyone should get less colds and flu. Quote Link to comment Share on other sites More sharing options...
Ali in OR Posted June 30, 2020 Share Posted June 30, 2020 Oregon's governor extended the mask requirement in public indoor spaces to all counties today. It had been just the 7 counties with highest numbers of cases. I'm glad it's consistent now. I am also hoping it will apply to high schools. I work in one, and so far the plan for fall is a hybrid model where kids can be online only or two days/week in building but online the rest of the time. But while they will require staff to mask, they weren't planning to require students to mask. I hope this directive will change that. 3 2 Quote Link to comment Share on other sites More sharing options...
Melissa in Australia Posted June 30, 2020 Share Posted June 30, 2020 (edited) 64 new cases in Vic today. 10 suburbs of Melbourne are going into very strict full lockdown. Not to leave house except absolutely essentials for 4 weeks Made a mistake I think. 30 suburbs, 10 postcode areas. It has just been announced and I am not clear on the fine details Edited June 30, 2020 by Melissa in Australia Adding more info 3 Quote Link to comment Share on other sites More sharing options...
Melissa in Australia Posted June 30, 2020 Share Posted June 30, 2020 Also no flights allowed into Melbourne at all for 2 weeks. 1 Quote Link to comment Share on other sites More sharing options...
Laura Corin Posted June 30, 2020 Share Posted June 30, 2020 (edited) One city in England with worse data is having lockdown extended. That seems sensible to me. https://www.theguardian.com/uk-news/2020/jun/30/leicester-lockdown-extension-law-change-matt-hancock-coronavirus?CMP=Share_AndroidApp_Copy_to_clipboard Meanwhile Scotland is talking about quarantine for people coming from England. https://www.theguardian.com/world/2020/jun/29/sturgeon-refuses-to-rule-out-scotland-screening-visitors-from-england?CMP=Share_AndroidApp_Copy_to_clipboard ETA death rate is back to normal for the UK, but the situation still feels fragile to me https://www.bbc.co.uk/news/health-53233066 Edited June 30, 2020 by Laura Corin 3 Quote Link to comment Share on other sites More sharing options...
MEmama Posted June 30, 2020 Share Posted June 30, 2020 Laura, Do you have any idea whether US students will be admitted into the country? I know the EU is looking to (understandably) restrict Americans, but I wonder if you have any insight into whether students are exempt. The university (I think yours) has a 14 day quarantine in place for international students. DS is anxious for a friend. Quote Link to comment Share on other sites More sharing options...
Pawz4me Posted June 30, 2020 Share Posted June 30, 2020 I've been poking around online to see what our schools here in NC are considering for re-opening. It looks like there are two plans -- Both would have K through 3rd grades in school every day. The first plan would then split grades 4-12 between the middle and high school facilities and 50 percent of the students would attend in person one week and school from home the next week. The second plan would have grades 4-8 going in person every day, spaced out in the middle and high schools, and grades 9-12 would do online classes only. I see all sorts of pros and cons with both. I'm glad I don't have to make the decision. 2 Quote Link to comment Share on other sites More sharing options...
DoraBora Posted June 30, 2020 Share Posted June 30, 2020 8 hours ago, Ktgrok said: https://www.msn.com/en-us/Health/medical/world-s-dominant-strain-of-coronavirus-is-10-times-more-infectious-than-the-one-that-jumped-to-humans-in-china-because-it-mutated-so-its-vital-spike-protein-doesn-t-snap-as-often-in-the-body-scientists-say/ar-BB167e7l?ocid=ob-fb-enus-280&fbclid=IwAR1iy_3krSHwjGW2-VidI6S7JCInNGWvzsaGpV61jlJGyt8wPLaj9KdQduo What a title! 3 Quote Link to comment Share on other sites More sharing options...
Laura Corin Posted June 30, 2020 Share Posted June 30, 2020 51 minutes ago, MEmama said: Laura, Do you have any idea whether US students will be admitted into the country? I know the EU is looking to (understandably) restrict Americans, but I wonder if you have any insight into whether students are exempt. The university (I think yours) has a 14 day quarantine in place for international students. DS is anxious for a friend. My university is set up for quarantine as necessary - segregated accommodation. It's hard to know if the UK will impose the same restrictions. Brexit again. The EU is recommending quarantine for people coming from the US, but it's not binding on member states, so I just don't know. If it is a Scottish university the likelihood of quarantine is higher - our numbers are better than in England, and the First Minister wants to keep them that way. 1 Quote Link to comment Share on other sites More sharing options...
MEmama Posted June 30, 2020 Share Posted June 30, 2020 12 minutes ago, Laura Corin said: My university is set up for quarantine as necessary - segregated accommodation. It's hard to know if the UK will impose the same restrictions. Brexit again. The EU is recommending quarantine for people coming from the US, but it's not binding on member states, so I just don't know. If it is a Scottish university the likelihood of quarantine is higher - our numbers are better than in England, and the First Minister wants to keep them that way. Thank you. He will be quarantining upon arrival, assuming he’s allowed in to the country at all. That’s the part that he seems unsure about at this point. Quote Link to comment Share on other sites More sharing options...
TracyP Posted June 30, 2020 Share Posted June 30, 2020 12 hours ago, Pen said: Study re Barcelona sewage that had detected some SARS2 sequence fragments (ones used for testing in France PCR tests, I think) in a March 2019 sample. Apparently Barcelona has a lot of workers from the Wuhan area, a lot of travel back and forth. this is looking more persuasive now https://www.medrxiv.org/content/10.1101/2020.06.13.20129627v1 This is interesting if it holds true. It seems to make this less likely to be lab modified (a theory I have been open to...) This, along with the article @Ktgrok posted gives a possibly clearer picture of how this virus evolved. Quote Link to comment Share on other sites More sharing options...
Laura Corin Posted June 30, 2020 Share Posted June 30, 2020 6 minutes ago, MEmama said: Thank you. He will be quarantining upon arrival, assuming he’s allowed in to the country at all. That’s the part that he seems unsure about at this point. I personally would be very surprised if he was barred. Scotland needs overseas student fees. That's just my personal hunch, though. 1 Quote Link to comment Share on other sites More sharing options...
Wheres Toto Posted June 30, 2020 Share Posted June 30, 2020 NJ governor just stopped the opening of indoor dining due to people crowding at outdoor bars. I'm glad that he's willing to react to what's actually happening. Makes me think we may actually manage to avoid a resurgence. 5 Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 (edited) 31 minutes ago, TracyP said: This is interesting if it holds true. It seems to make this less likely to be lab modified (a theory I have been open to...) This, along with the article @Ktgrok posted gives a possibly clearer picture of how this virus evolved. Do you mean about the spike protein change? How do you see either or both to make lab modification less likely? (ETA I had seen the study the msn article seems based on when someone first had posted about the Scripps and Los Alamos studies here. They seemed neither to increase nor decrease possibility of origin in laboratory.) Edited June 30, 2020 by Pen Quote Link to comment Share on other sites More sharing options...
Kanin Posted June 30, 2020 Share Posted June 30, 2020 8 minutes ago, Where's Toto? said: NJ governor just stopped the opening of indoor dining due to people crowding at outdoor bars. I'm glad that he's willing to react to what's actually happening. Makes me think we may actually manage to avoid a resurgence. I saw Andrew Cuomo on Meet the Press the other day, and he was talking about how the surge in cases in other states may delay opening in NY and other places. It only makes sense... but I wish we had a national response to this! If NYC is doing really well and is capable of opening restaurants, but they can't because they're afraid people from Florida will come spread the virus, it's just nuts. Perhaps the governors will create a national plan on their own. 5 Quote Link to comment Share on other sites More sharing options...
TracyP Posted June 30, 2020 Share Posted June 30, 2020 Just now, Pen said: Do you mean about the spike protein change? How do you see either or both to make lab modification less likely? I have been fairly skeptical that the virus was lab modified in the first place. I have, however, seen a few things that led me to be open to the idea. The most convincing was the study that showed the mutations that would have taken place between the animal virus and what we have now. The authors said that the likelihood of the virus making those changes based on the current timeline was virtually impossible without outside help. (This was linked in this thread. I can look for it if you want but I will probably never find it now...) If a form of this virus was circulating (and undoubtedly modifying in many ways) 9-10 mos before we thought, then the piece of evidence I found most convincing no longer applies. Quote Link to comment Share on other sites More sharing options...
Guest Posted June 30, 2020 Share Posted June 30, 2020 14 hours ago, square_25 said: I was thinking that, actually... how much preschool would DD4 attend, anyway, if I didn't send her whenever she had symptoms? That's one reason why I am keeping my pro Zoom subscription. I really expect that even if I have students officially "in person", we'll end up doing about half the lessons virtually due to cold Symptoms. Heck, if I had tried to teach in person this summer, I would have felt obligated to go online about half the time due to symptoms that are probably just allergies, but I don't want to take any chances. 1 Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 4 minutes ago, TracyP said: I have been fairly skeptical that the virus was lab modified in the first place. I have, however, seen a few things that led me to be open to the idea. The most convincing was the study that showed the mutations that would have taken place between the animal virus and what we have now. The authors said that the likelihood of the virus making those changes based on the current timeline was virtually impossible without outside help. (This was linked in this thread. I can look for it if you want but I will probably never find it now...) If a form of this virus was circulating (and undoubtedly modifying in many ways) 9-10 mos before we thought, then the piece of evidence I found most convincing no longer applies. Ah. I see. There was a single frozen waste water sample from March 12, 2019 that showed two types of genetic sequence fragments consistent with SARS2 (but was negative for several other PCR sequences). It then apparently doesn’t show up again until January 15, 2020 at which point it shows a rising graph consistent with the waste water as an early sentinel to cases appearing in the population. And decreases consistent with either storms diluting the waste water, or shut down decreasing cases. January in Spain is very much consistent with indications that the virus was in Wuhan in late summer to mid autumn of 2019 (not first from a seafood market in November) and fits with indications of problems at the Laboratory being reported as possible. Plus indications of increased internet searches for SARS2 CV19 type symptoms in Wuhan area in ~ October. The single March 12 positive sample is an oddity. And IMO needs further investigation. I’d like to see another research group test the March 12 frozen sample to confirm presence of the sequences, and also do testing of samples from elsewhere if anywhere else keeps frozen samples. South Korea, Italy, New York, areas would be interesting to have similar tests. Also an oddity is that the positive sequences in March are apparently on the the Pasteur Institute test sequences—and a Pasteur Institute scientist particularly thinks that SARS2 was of Laboratory origins. As interesting as the findings that waste water is a good early sentinel were, running tests for several different countries’ diagnostic testing sequences seemed interesting for possibly showing that not all sequences were necessarily positive — which is another issue imo with regard to false positive and false negative test results. The March 12, 2019 sample results are fascinating, and assuming accuracy and that the sample wasn’t contaminated, beg the question of what that means. https://www.medrxiv.org/content/10.1101/2020.06.13.20129627v1 particularly the results charts 1 Quote Link to comment Share on other sites More sharing options...
MEmama Posted June 30, 2020 Share Posted June 30, 2020 This is what happens when things reopen. It was done with good intentions and seemed like a great idea; several streets in the Old Port were closed to traffic to allow for restaurants to offer spaced out, outdoor seating. But apparently people cannot be trusted to make good decisions and this is why we cannot have nice things. 😞 7 Quote Link to comment Share on other sites More sharing options...
Kanin Posted June 30, 2020 Share Posted June 30, 2020 6 minutes ago, MEmama said: This is what happens when things reopen. It was done with good intentions and seemed like a great idea; several streets in the Old Port were closed to traffic to allow for restaurants to offer spaced out, outdoor seating. But apparently people cannot be trusted to make good decisions and this is why we cannot have nice things. 😞 I just don't get it! Do people really not consume any news.... like enough news to know what's happening in the south, and what's already happened in NY, NJ, etc? And they think that won't happen here? Here's a good, non-Covid-specific, demonstration of how droplets move through the air, and how well masks contain them (spoiler alert: really well!): https://www.khq.com/news/khq-investigates-how-effective-is-a-mask/video_e308a1e8-b74f-11ea-ac6d-878bd6f54032.html?utm_source=TWITTER&utm_medium=social_organic&utm_term=3456877239___&utm_content=_News+Promotion&utm_campaign=_ 2 Quote Link to comment Share on other sites More sharing options...
vonfirmath Posted June 30, 2020 Share Posted June 30, 2020 (edited) 15 minutes ago, Kanin said: I just don't get it! Do people really not consume any news.... like enough news to know what's happening in the south, and what's already happened in NY, NJ, etc? And they think that won't happen here? Here's a good, non-Covid-specific, demonstration of how droplets move through the air, and how well masks contain them (spoiler alert: really well!): https://www.khq.com/news/khq-investigates-how-effective-is-a-mask/video_e308a1e8-b74f-11ea-ac6d-878bd6f54032.html?utm_source=TWITTER&utm_medium=social_organic&utm_term=3456877239___&utm_content=_News+Promotion&utm_campaign=_ Did you see the news report about the way a picture is taken can make it look more crowded than it actually is? It's made me much more skeptical of pictures like this. Maybe the people in person, look around. See they have adequate spacing between groups. Not realizing there is someone with a camera looking to take a picture that makes it look horrible. https://www.businessinsider.com/social-distancing-images-camera-trick-2020-4?op=1#the-debate-began-when-a-danish-news-site-published-side-by-side-photos-of-various-public-areas-in-copenhagen-while-the-images-depicted-the-same-scenes-their-perspectives-were-dramatically-different-2 Edited June 30, 2020 by vonfirmath Add link 3 2 Quote Link to comment Share on other sites More sharing options...
MEmama Posted June 30, 2020 Share Posted June 30, 2020 7 minutes ago, square_25 said: Is this outdoors? Then it may be OK. (Although they really do need to mask up.) Yes, it’s a street scene. Plenty of them. Definitely not doctored. Lol. I disagree that this is okay. It’s lunacy. And now I will forgo any and all reasons this summer to go down to Portland to you know, support local businesses. Nope. Quote Link to comment Share on other sites More sharing options...
TCB Posted June 30, 2020 Share Posted June 30, 2020 16 minutes ago, vonfirmath said: Did you see the news report about the way a picture is taken can make it look more crowded than it actually is? It's made me much more skeptical of pictures like this. Maybe the people in person, look around. See they have adequate spacing between groups. Not realizing there is someone with a camera looking to take a picture that makes it look horrible. https://www.businessinsider.com/social-distancing-images-camera-trick-2020-4?op=1#the-debate-began-when-a-danish-news-site-published-side-by-side-photos-of-various-public-areas-in-copenhagen-while-the-images-depicted-the-same-scenes-their-perspectives-were-dramatically-different-2 Do you think the same is true of video? I think the difference in the Petri dishes would still be convincing even if they did something to exaggerate the unmasked ones but it would be good to know if they can do it for video as well when trying to evaluate things. Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 (edited) 46 minutes ago, vonfirmath said: Did you see the news report about the way a picture is taken can make it look more crowded than it actually is? It's made me much more skeptical of pictures like this. Maybe the people in person, look around. See they have adequate spacing between groups. Not realizing there is someone with a camera looking to take a picture that makes it look horrible. https://www.businessinsider.com/social-distancing-images-camera-trick-2020-4?op=1#the-debate-began-when-a-danish-news-site-published-side-by-side-photos-of-various-public-areas-in-copenhagen-while-the-images-depicted-the-same-scenes-their-perspectives-were-dramatically-different-2 Misleading photos could also give people the impression that gatherings of close grouped people (at least outside) are safe. While viewers would not realize that the distances between the people that didn’t lead to case spikes were much larger than images made it appear. Edited June 30, 2020 by Pen 3 Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 17 minutes ago, TCB said: Do you think the same is true of video? I think the difference in the Petri dishes would still be convincing even if they did something to exaggerate the unmasked ones but it would be good to know if they can do it for video as well when trying to evaluate things. Good homeschooling experiment if you can get some agar plates currently! a friend of my son’s did an experiment with bacteria growing on agar after various times exposed to dirty conditions (a floor for example), and found that linger exposures did increase bacteria load, though it was already significant even with short exposure. If you try the experiment at home, I wish you would do it with a typical amount of time that singing might happen in church, or talking in a class or meeting! Quote Link to comment Share on other sites More sharing options...
TCB Posted June 30, 2020 Share Posted June 30, 2020 8 minutes ago, Pen said: Good homeschooling experiment if you can get some agar plates currently! a friend of my son’s did an experiment with bacteria growing on agar after various times exposed to dirty conditions (a floor for example), and found that linger exposures did increase bacteria load, though it was already significant even with short exposure. If you try the experiment at home, I wish you would do it with a typical amount of time that singing might happen in church, or talking in a class or meeting! I can see that collecting samples using different times or methods could skew the results. I was wondering if you could alter their appearance visually with video like you can with still photography. Don’t know if I’m technologically skilled enough to do it myself but I could try. Quote Link to comment Share on other sites More sharing options...
MEmama Posted June 30, 2020 Share Posted June 30, 2020 51 minutes ago, vonfirmath said: Did you see the news report about the way a picture is taken can make it look more crowded than it actually is? It's made me much more skeptical of pictures like this. Maybe the people in person, look around. See they have adequate spacing between groups. Not realizing there is someone with a camera looking to take a picture that makes it look horrible. https://www.businessinsider.com/social-distancing-images-camera-trick-2020-4?op=1#the-debate-began-when-a-danish-news-site-published-side-by-side-photos-of-various-public-areas-in-copenhagen-while-the-images-depicted-the-same-scenes-their-perspectives-were-dramatically-different-2 Sure, camera lenses and angles can do all kinds of things. In this case though, the streets are really narrow. Count the people in a general row though in these little alleyways and yup, it’s a problem. On a regular Saturday night this would be awesome, but now it’s just stupid. And I’m mad. 1 1 Quote Link to comment Share on other sites More sharing options...
Matryoshka Posted June 30, 2020 Share Posted June 30, 2020 (edited) 3 minutes ago, MEmama said: Sure, camera lenses and angles can do all kinds of things. In this case though, the streets are really narrow. Count the people in a general row though in these little alleyways and yup, it’s a problem. On a regular Saturday night this would be awesome, but now it’s just stupid. And I’m mad. And without masks. I don't wear a mask when I walk on my quiet street, and I've even met a friend on my porch where we sit more than 6' apart. But a crowd of people like that? Masks, people, masks. I am very much of the opinion that outdoor risk of spread is much lower than indoors. But it's still far from zero, and the whole time + proximity thing when you're just standing around like that... outdoor air is also not magic fairy dust that renders you immune! Edited June 30, 2020 by Matryoshka 5 1 Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 4 minutes ago, TCB said: I can see that collecting samples using different times or methods could skew the results. I was wondering if you could alter their appearance visually with video like you can with still photography. Don’t know if I’m technologically skilled enough to do it myself but I could try. You probably can alter appearance with video, and can certainly completely change it in edit process. Do you disbelieve that what they said they did is what they did? Quote Link to comment Share on other sites More sharing options...
Pen Posted June 30, 2020 Share Posted June 30, 2020 @Arcadia @square_25 @mathnerd @dmmetler My Happy Mask came. I like it a lot. I ordered two for my mom (most vulnerable of us so she could switch it out if needed) and one for my son. I think they would be especially helpful for people in a big city or with underlying health issues or both. In addition to maybe being light and comfortable for kids. the filter membrane must be directional , in breath is easier than out it seems to me ... I hope they are as protective for wearer as the site says! 4 2 Quote Link to comment Share on other sites More sharing options...
Kanin Posted June 30, 2020 Share Posted June 30, 2020 2 hours ago, vonfirmath said: Did you see the news report about the way a picture is taken can make it look more crowded than it actually is? It's made me much more skeptical of pictures like this. Maybe the people in person, look around. See they have adequate spacing between groups. Not realizing there is someone with a camera looking to take a picture that makes it look horrible. I had not seen this. Thank you! Quote Link to comment Share on other sites More sharing options...
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.